Data related to "Structural and biochemical insight into the mechanism of dual CpG site binding and methylation by DNMT3A" (doi:10.18419/darus-1781)

View:

Part 1: Document Description
Part 2: Study Description
Part 5: Other Study-Related Materials
Entire Codebook

(external link)

Document Description

Citation

Title:

Data related to "Structural and biochemical insight into the mechanism of dual CpG site binding and methylation by DNMT3A"

Identification Number:

doi:10.18419/darus-1781

Distributor:

DaRUS

Date of Distribution:

2021-04-12

Version:

1

Bibliographic Citation:

Jeltsch, Albert; Bashtrykov, Pavel; Adam, Sabrina; Kunert, Stefan, 2021, "Data related to "Structural and biochemical insight into the mechanism of dual CpG site binding and methylation by DNMT3A"", https://doi.org/10.18419/darus-1781, DaRUS, V1

Study Description

Citation

Title:

Data related to "Structural and biochemical insight into the mechanism of dual CpG site binding and methylation by DNMT3A"

Identification Number:

doi:10.18419/darus-1781

Authoring Entity:

Jeltsch, Albert (Universität Stuttgart)

Bashtrykov, Pavel (Universität Stuttgart)

Adam, Sabrina (Universität Stuttgart)

Kunert, Stefan (Universität Stuttgart)

Grant Number:

JE 252/6

Grant Number:

JE 252/15

Distributor:

DaRUS

Access Authority:

Jeltsch, Albert

Depositor:

Jeltsch, Albert

Date of Deposit:

2021-04-05

Study Scope

Keywords:

Chemistry, Medicine, Health and Life Sciences, DNA Methylation, DNA Methyltransferase, NGS Bisulfite Sequencing, Enzyme assays, DNMT3A, DNMT3L, Co-methylation

Abstract:

Methylation of substrate libraries<br> Single-stranded DNA oligonucleotides used for generation of double stranded substrates with different distance between CpG sites were obtained from IDT. Sixteen single-stranded oligonucleotides were pooled in equimolar amounts and the second strand synthesis was conducted by a primer extension reaction using one universal primer. The obtained mix of double-stranded DNA oligonucleotides was methylated by DNMT3A catalytic domain and DNMT3A/3L and incubated for 60 min at 37 °C in the presence of 0.8 mM S-adenosyl-L-methionine (Sigma) in reaction buffer (20 mM HEPES pH 7.5, 1 mM EDTA, 50 mM KCl, 0.05 mg/mL bovine serum albumin). For DNMT3A, concentrations of 0.25 µM, 0,5 µM, 1 µM and 2 µM were used, for DNMT3A/3L 0.125 µM and 0.25 µM. In addition, a no-enzyme control was processed identically to all other samples. Reactions were stopped by shock freezing in liquid nitrogen, then treated with proteinase K for 2 hours at 42 °C. Afterwards DNA was digested with BsaI-HFv2 enzyme and a hairpin (pGAGAAGGGATGTGGATACACATCCCT) was ligated using T4 DNA ligase (NEB). DNA was bisulfite converted using EZ DNA Methylation-Lightning kit (ZYMO RESEARCH) according to the manufacturer protocol, purified and eluted with 10 µL ddH2O.<br><br> NGS library generation<br> Libraries for Illumina Next Generation Sequencing (NGS) were produced with the two-step PCR approach. In the first PCR, 2 µL of bisulfite-converted DNA were amplified with the HotStartTaq DNA Polymerase (QIAGEN) and primers containing internal barcodes using following conditions: 15 min at 95 °C, 10 cycles of 30 sec at 94 °C, 30 sec at 50 °C, 1 min and 30 sec at 72 °C, and final 5 min at 72 °C; using a mixture containing 1x PCR Buffer, 1x Q-Solution, 0.2 mM dNTPs, 0.05 U/µL HotStartTaq DNA Polymerase, 0.4 µM forward and 0.4 µM reverse primers in a total volume of 20 µL. In the second PCR, 1 µL of obtained products were amplified by Phusion Polymerase (Thermo) with another set of primers to introduce adapters and indices needed for NGS (30 sec at 98 °C, 10 cycles - 10 sec at 98 °C, 40 sec at 72 °C, and 5 min at 72 °C). PCRII was carried out in 1x Phusion HF Buffer, 0.2 mM dNTPs, 0.02 U/µL Phusion HF DNA Polymerase, 0.4 µM forward and 0.4 µM reverse primers in a total volume of 20 µL. Obtained libraries were pooled in equimolar amounts, purified and sequenced in the Max Planck Genome Centre Cologne.<br><br> Bioinformatic analysis<br> Bioinformatic analysis of obtained NGS data was conducted with a local Galaxy server and with home written scripts. Briefly, fastq files were analyzed by FastQC, 3’ ends of the reads with a quality lower than 20 were trimmed and reads containing both full-length sense and antisense strands were selected. Next, the samples were split using the internal barcodes with respect to the different experimental conditions. Afterwards the insert DNA sequence was extracted and used for further downstream analysis. The uploaded text files contain the bisulfite converted sequences with pairs of CpG sites in variable distance as described in the furhter documentation (info.pdf).

Kind of Data:

DNA sequences after hairpin ligation and bisulfite conversion

Methodology and Processing

Sources Statement

Data Sources:

Bisulfite-seq DNA methylation analysis

Data Access

Notes:

CC BY Waiver

Other Study Description Materials

Related Publications

Citation

Identification Number:

10.1093/nar/gkab600

Bibliographic Citation:

Emperle M, Bangalore DM, Adam S, Kunert S, Heil HS, Heinze KG, Bashtrykov P, Tessmer I, Jeltsch A. Structural and biochemical insight into the mechanism of dual CpG site binding and methylation by the DNMT3A DNA methyltransferase. Nucleic Acids Res,Volume 49, Issue 14, 20 August 2021, Pages 8294-8308.

Other Study-Related Materials

Label:

DNMT3A_0.25uM.txt

Notes:

text/plain

Other Study-Related Materials

Label:

DNMT3A_0.5uM.txt

Notes:

text/plain

Other Study-Related Materials

Label:

DNMT3A_1uM.txt

Notes:

text/plain

Other Study-Related Materials

Label:

DNMT3A_2uM.txt

Notes:

text/plain

Other Study-Related Materials

Label:

DNMT3A3L_0.125uM.txt

Notes:

text/plain

Other Study-Related Materials

Label:

DNMT3A3L_0.25uM.txt

Notes:

text/plain

Other Study-Related Materials

Label:

info.pdf

Text:

Further description of the sequences

Notes:

application/pdf

Other Study-Related Materials

Label:

no_enzyme_control.txt

Notes:

text/plain